GMMPS is a windows-version program. Under the menu "GMMPS", there are the following three different sub-minus for run the program on one sequence once (Single Run), multiple times (Repeatedly Run), and run on different sequence sets (Multiple inputs). For each case, just click the corresponding menu and select the input file. The input files are built as follows. 1) Single Run All the input parameters should be specified in a txt file. The following is an example for the input txt file: *********************************************** -i F:\Projects\GMMPS\Data\Example_Seq.txt -o F:\Projects\GMMPS\Data\Example_results.txt -b F:\Projects\GMMPS\Data\Background_PM.txt -w 10 -r 0 -n 500 -s 1 ************************************************* In the above file, "-i" is the path for input sequence file. The input sequence file should be fasta format, i.e. >seq1 AACCGGTTGACCGGTTGAAACCCAAAAAAAGGGTATG >seq2 GGTAAACCGGCTAGCGATCGATCGACTGACTAGCTAGCATCGACTAGCTAG >seq3 ... "-o" is the path for the output result file. "-b" is the parameter file for the 1st order Markov chain. We have an example background file: "Background_PM.txt". "-W" is the width of the target motif. "-r" specifies sampling backward strand or not. If 0, only forward strand will be sampled. If 1, both strands will be sampled. "-n" total number of iterations. "-s" number of pseudo-counts in each position. 2) Repeatedly Run If you want to run GMMPS on one sequence set for multiple times. Add one more parameter in the input file: -N 5 3) Multiple inputs If you want to run GMMPS on several different sequence sets continuously, build a hyper input file. For example: ****************** 2 F:\Projects\GMMPS\Data\GMMPS_inputs_1.txt F:\Projects\GMMPS\Data\GMMPS_inputs_2.txt ******************* In the file, the first line specifies how many different sequence sets you are to run. The following lines are the input files for each sequence set. We have a simulated sequence sets (Example_Seq.txt) with known motif sites (Example_Seq.motif.txt) in the package. And an output file for this dataset is also attached (Example_results.txt).